View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10095_low_7 (Length: 248)
Name: NF10095_low_7
Description: NF10095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10095_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 35 - 242
Target Start/End: Original strand, 23717982 - 23718189
Alignment:
| Q |
35 |
ctatttcaaaacacagatatgagacgaataacgaggatatggacactcatcccgaatctatactcaaatatgttccaaaatgtagaaaatactttacttc |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23717982 |
ctatttcaaaacacagatatgagacgaataacgaggatatggacacccatcccgaatctatactcaaatatgttccaaaatgtagaaaatactttacttc |
23718081 |
T |
|
| Q |
135 |
ccatttattagtcattttatataaacagaaactccctggattatttttctcagtcaaatagagtgtcagtctgttagacgacactcactcgagttcgctc |
234 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23718082 |
ccatttattagtcattttatataaatagaaactccctggatcatttttctcagtcagttagagtgtcagtctgttagacgacactcactcgagttcgctc |
23718181 |
T |
|
| Q |
235 |
tctgcttc |
242 |
Q |
| |
|
||| |||| |
|
|
| T |
23718182 |
tcttcttc |
23718189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University