View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10096_low_10 (Length: 250)
Name: NF10096_low_10
Description: NF10096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10096_low_10 |
 |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0001 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 194022 - 193787
Alignment:
| Q |
1 |
aagcaaaataattttcatattgtattaacactaaagctgagctctatagnnnnnnnnccccagtattatataagttcattccttcttgttgaattgtttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
194022 |
aagcaaaataattttcatattgtattaacactaaagctgagctctatagttttttttccccagtattatataagttcattccttcttgttgaattgtttt |
193923 |
T |
 |
| Q |
101 |
ttctgacattgctgttgctgaataaatattacagatatcttgcggtaagttgacaatccaattgctattcgcctgttctcaatgtgtgatcttaggatta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
193922 |
ttctgacattgctgttgctgaataaatattacagatatcttgcggtaagttgacaatccaatagctattcgcctgttctcaatgtgtgatcttaggatta |
193823 |
T |
 |
| Q |
201 |
nnnnnnnattaggttgtccatgttaaagtgtgtctt |
236 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
193822 |
tttttttattaggttgtccatgttaaagtgtgtctt |
193787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University