View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10096_low_15 (Length: 232)
Name: NF10096_low_15
Description: NF10096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10096_low_15 |
 |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0001 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 194482 - 194700
Alignment:
| Q |
1 |
tgttctgcctacatcgactcccatagtccaattaataccgaaaaccaaaccagtaaagttcagtgtcaagaagctcttaaaagaataaatttacatnnnn |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
194482 |
tgttctgcctacatcgactcccatagtccaattaataccgaaaaccaaaccagtaaagtgcagtgtcaagaagctcttaaaagaataaatttacattaaa |
194581 |
T |
 |
| Q |
101 |
nnnnnnnnnnnc---cagccaacatgaaacgagtactaagcgaaacaatcaattttaggcattaagcaacattcatagattgcttcaattgttccctgag |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
194582 |
aaaaaaaaaaaaaaacagccaacatgaaacgagtactaagcgaaacaatcaattt-aggcattaagcaacattcatagattgcttcaattgttccctgag |
194680 |
T |
 |
| Q |
198 |
gcagcatttttataaaaact |
217 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
194681 |
gcagcatttttataaaaact |
194700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University