View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10096_low_16 (Length: 229)
Name: NF10096_low_16
Description: NF10096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10096_low_16 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 9 - 229
Target Start/End: Original strand, 8978706 - 8978926
Alignment:
| Q |
9 |
aaggtgtgaaaggagcatatgcatctttacccgcaaccactaaatgctcaagaagtgtgtgcgagtggtgaaagccttttaagaaaaaataaagtatttg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8978706 |
aaggtgtgaaaggagcatatgcatctttacccgcaaccactaaatgctcaagaagtgtgtgcgagtggtgaaagccttttaagaaaaaataaagtatttg |
8978805 |
T |
 |
| Q |
109 |
aatatgaataggtttaatggaaaacactaaagtgtatgcgagcaagaagattgaaagaatatcgtaatattatttgtcagaatattcttttttcaggagt |
208 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
8978806 |
aatatgaataggtttaatggaaaacagtaaagtgtatgcgagcaagaagattgaaagaatatcgtaatattatttgtcagaatattctttttctaggagt |
8978905 |
T |
 |
| Q |
209 |
ttgtcatgtttttctctcaat |
229 |
Q |
| |
|
||||||| ||||||||||||| |
|
|
| T |
8978906 |
ttgtcatttttttctctcaat |
8978926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 56
Target Start/End: Original strand, 17116401 - 17116450
Alignment:
| Q |
7 |
gtaaggtgtgaaaggagcatatgcatctttacccgcaaccactaaatgct |
56 |
Q |
| |
|
||||||||||||| || ||| |||||||||||| |||| ||||||||||| |
|
|
| T |
17116401 |
gtaaggtgtgaaatgaacatctgcatctttaccggcaatcactaaatgct |
17116450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University