View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10096_low_17 (Length: 229)
Name: NF10096_low_17
Description: NF10096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10096_low_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 85; Significance: 1e-40; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 81 - 217
Target Start/End: Complemental strand, 33415865 - 33415729
Alignment:
Q |
81 |
acaacaaccaaactcaaatacacagatatcattatattattgtgtttatatatcatgtagtcacacatttcacttacaatggataatgaagaaaaacctc |
180 |
Q |
|
|
|||||| | ||||||||||||||| ||| |||||||||||||||||||| |||||| ||||||| ||||||||||||| || ||| |||||||||||| |
|
|
T |
33415865 |
acaacagcaaaactcaaatacacaaataccattatattattgtgtttatctatcataaagtcacaaatttcacttacaacagagaataaagaaaaacctc |
33415766 |
T |
 |
Q |
181 |
aatatgtctcaaattcgtatttgatacaaatgcttca |
217 |
Q |
|
|
||||||||||||||||||||||||||||||| ||||| |
|
|
T |
33415765 |
aatatgtctcaaattcgtatttgatacaaatacttca |
33415729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 142 - 216
Target Start/End: Complemental strand, 33410386 - 33410312
Alignment:
Q |
142 |
cacacatttcacttacaatggataatgaagaaaaacctcaatatgtctcaaattcgtatttgatacaaatgcttc |
216 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33410386 |
cacacatttcacttacaatggataatgaagaaaaacctcaatatgtctcaaattcgtatttgatacaaatgcttc |
33410312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 100 - 155
Target Start/End: Complemental strand, 33412896 - 33412841
Alignment:
Q |
100 |
acacagatatcattatattattgtgtttatatatcatgtagtcacacatttcactt |
155 |
Q |
|
|
||||| ||||||||||||||| ||||||||||||||| |||| ||||||||||||| |
|
|
T |
33412896 |
acacaaatatcattatattatcgtgtttatatatcatatagtgacacatttcactt |
33412841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University