View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10096_low_4 (Length: 333)
Name: NF10096_low_4
Description: NF10096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10096_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 319
Target Start/End: Complemental strand, 5488410 - 5488088
Alignment:
Q |
1 |
tgatgtgtttaaatcttgatctctacttatgacactatagttgatcaactataa--tttatgatgggtcaccaaattggtttttaagagttagttactcc |
98 |
Q |
|
|
||||||||||||||||||||| ||||||||||||||| ||||||||||||||| |||||||||| |||||||||| ||||||||||||||||| | | |
|
|
T |
5488410 |
tgatgtgtttaaatcttgatccctacttatgacactacagttgatcaactatagagtttatgatggatcaccaaattaatttttaagagttagttatttc |
5488311 |
T |
 |
Q |
99 |
aagtacacttcaagtcgttacgttgtactcgttca--atcttttaccaatctaattcattctttatgaatatttacgagtatcacctcatgaatggtcct |
196 |
Q |
|
|
|| ||||||| | ||||||| |||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5488310 |
aaatacactttagatcgttacattgtacgcgttcattatcttttaccaatctaattcattctttatgaatatttacgagtatcacctcatgaatggtcct |
5488211 |
T |
 |
Q |
197 |
atatttgctttcctgttgtatcattgttatgattttcttccccacaataccatgattcataatactactctaaaggaaatcctgctgcattgaaaaatag |
296 |
Q |
|
|
|| |||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
5488210 |
atgtttgctttcctgctgtatcattgttatgattttcttccctacaataccatgattcataatactactctaaaggaaatcctgctgccttgaaaaatag |
5488111 |
T |
 |
Q |
297 |
atatgcttcaattattgctattc |
319 |
Q |
|
|
||||||||||||||||||||||| |
|
|
T |
5488110 |
atatgcttcaattattgctattc |
5488088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University