View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10096_low_7 (Length: 254)
Name: NF10096_low_7
Description: NF10096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10096_low_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 208; Significance: 1e-114; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 2705968 - 2706199
Alignment:
| Q |
1 |
ttgtctatctatgattttatattgggtctgcaaccaaaattgtggtcgcaacataaaaactttcaagtctttacaactcgattgcaactgcaattgaggc |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2705968 |
ttgtctatctatggttttatattgggtctgcaaccacaattgtggtcgcaacataaaaactttcaagtctttacaactcgattgcaactgcaatggaggc |
2706067 |
T |
 |
| Q |
101 |
cgcatcagcagtatttgttcacgttttcacaatatgaagacgaaaccacaatatagaactatgagtttaacctgtaatttataaaatttctaaccaattt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2706068 |
cgcatcagcagtatttgttcacgttttcacaatatgaagacgaaaccacaatatagaactaggagtttaacctgtaatttataaaatttctaaccaattt |
2706167 |
T |
 |
| Q |
201 |
cataatagatttatttcttaatctatcgtcct |
232 |
Q |
| |
|
|| |||||||||||||||||||||||||||| |
|
|
| T |
2706168 |
tattatagatttatttcttaatctatcgtcct |
2706199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 1 - 199
Target Start/End: Original strand, 2697040 - 2697241
Alignment:
| Q |
1 |
ttgtctatctatgattttatattgggtctgcaaccaaaattgtggtcgcaacataaaaactttcaagtctttacaactcgattgcaactgcaattgaggc |
100 |
Q |
| |
|
|||||||| |||| |||||||| ||| | |||||| ||| |||| |||||||||| ||||| || ||||| || | ||| || || ||||||||||| |
|
|
| T |
2697040 |
ttgtctatttatggttttatatcaggtttacaaccacgattatggttgcaacataaatactttgaaacctttaaaaattgatcgctacagcaattgaggc |
2697139 |
T |
 |
| Q |
101 |
cgcatcagcagtatttgttcacgttttcacaatatgaagacgaaaccacaatatagaactatgagt---ttaacctgtaatttataaaatttctaaccaa |
197 |
Q |
| |
|
|||||| || ||||||||||||||||||||||||||| |||||||||||| ||||||||| ||| ||||||| || ||||||||||||||||| || |
|
|
| T |
2697140 |
tacatcagtagcatttgttcacgttttcacaatatgaagtcgaaaccacaatttagaactatcagtctattaacctttattttataaaatttctaacaaa |
2697239 |
T |
 |
| Q |
198 |
tt |
199 |
Q |
| |
|
|| |
|
|
| T |
2697240 |
tt |
2697241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University