View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10097_high_5 (Length: 242)
Name: NF10097_high_5
Description: NF10097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10097_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 40899912 - 40899674
Alignment:
| Q |
1 |
ttctcataatgtcatgccatttattatgtatgttaatatttttggttgccaacttactgattgtaagagcttatagtgttttcaccattcaatatttaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40899912 |
ttctcataatgtcatgccatttattatgtatgttaatatttttggttgccaacttactgattgtaagagcttatagtgttttcaccattcaatatttaca |
40899813 |
T |
 |
| Q |
101 |
tgaatatgattttattgagtttccaatgcagatatcaactgcgcatattgatcacatcttcaagactcaataactttgcttttcaatggcattacagcct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40899812 |
tgaatatgattttattgagtttccaatgtagatatcaactgagcatattgatcacatcttcaagactcaataactttgcttttcaatggcattacagcct |
40899713 |
T |
 |
| Q |
201 |
ttgtctaccgtgatcttactggtatatttataagttcat |
239 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
40899712 |
ttgtctatcgtgatcttactggtatatttataagttcat |
40899674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University