View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10097_low_11 (Length: 241)
Name: NF10097_low_11
Description: NF10097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10097_low_11 |
 |  |
|
[»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 19 - 241
Target Start/End: Complemental strand, 27409560 - 27409338
Alignment:
Q |
19 |
cggactacccctctcataacctagttaacaagatatgacattgcttcttcaactgaaacaaacccaaccgactttcggtgaaggaggacactgttccgac |
118 |
Q |
|
|
||||||| ||||||||||||||||||||||||||||||| ||||||||||| ||||||| ||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
27409560 |
cggactaaccctctcataacctagttaacaagatatgacgctgcttcttcaattgaaacagacccaaccgactttcggtgaaggaggacattgttccgac |
27409461 |
T |
 |
Q |
119 |
cattggatatatcctaaatggaatgagaatgaagtatacactcgattttcgaagatcaggatctttggtgtacttcattcactcagactatcgctttggt |
218 |
Q |
|
|
|||| |||||||||||||||||||||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||||||||||| ||||| | || |
|
|
T |
27409460 |
cattcaatatatcctaaatggaatgagaatgaagcatacacttgattttcgaagatcaagatctttggtgtacttcattcactcagactgtcgctctcgt |
27409361 |
T |
 |
Q |
219 |
aacctagttaacgtaaagatttt |
241 |
Q |
|
|
||||||||||||||||||||||| |
|
|
T |
27409360 |
aacctagttaacgtaaagatttt |
27409338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University