View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10097_low_13 (Length: 229)
Name: NF10097_low_13
Description: NF10097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10097_low_13 |
 |  |
|
[»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 4 - 229
Target Start/End: Complemental strand, 40900331 - 40900107
Alignment:
Q |
4 |
tcaatatagaggagctaaatccattttaggttgatgctcacaataatagaaaatccacctattaaattatttcattctaatccaccattggcttatctca |
103 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
40900331 |
tcaatatagaggagctaaatccattttaggttgatgctcacaataatagaaaatccacctattaaattatttcattataatccaccattggcttatctca |
40900232 |
T |
 |
Q |
104 |
aaaatttcagttctatgtttaaatatcattctagccaaaatgctaggcgattctaaagttttgatcatcactgaatacgaaattatattgcactaatttt |
203 |
Q |
|
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
T |
40900231 |
aaaatttcagttctatgtttaaatatcattc-ggccaaaatgctaggcgattctaaagttttgatcatcgctgaatacgaaattatattacactaatttt |
40900133 |
T |
 |
Q |
204 |
tggtggttataagtattatctcttgt |
229 |
Q |
|
|
| |||||||||||||||||||||||| |
|
|
T |
40900132 |
ttgtggttataagtattatctcttgt |
40900107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University