View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10097_low_4 (Length: 379)
Name: NF10097_low_4
Description: NF10097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10097_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-112; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 163 - 368
Target Start/End: Original strand, 5066946 - 5067151
Alignment:
| Q |
163 |
tagagggtaatgaagattttgccgagcttgttagagctgcttctgctagaactttaggtaatagaattgatgtggatttagttctcaagcagcaacatca |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5066946 |
tagagggtaatgaagattttgccgagcttgttagagctgcttctgctagaactttaggtaatagaattgatgtggatttagttctcaagcagcaacatca |
5067045 |
T |
 |
| Q |
263 |
acaacaacaacagaaattgcataaagggttacctaagtctagtagtgttggaatggctaagattgatgaggatatgccatttgattcctttgttgaagga |
362 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5067046 |
acaacaacaacagaaattgcataaagggttacctaagtctagtagtgttggaatggctaagattgatgaggatatgccatttgattcctttgttgaagga |
5067145 |
T |
 |
| Q |
363 |
aaagtt |
368 |
Q |
| |
|
|||||| |
|
|
| T |
5067146 |
aaagtt |
5067151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 12 - 100
Target Start/End: Original strand, 5066810 - 5066898
Alignment:
| Q |
12 |
agagatgcatacgtaagaagcataacaaactgtggtcaaaatatgagttatggtagttatccaatggatggtgctagtaaattttcttt |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5066810 |
agagatgcatatgtaagaagcataacaaactgtggtcaaaatatgagttatggtagttatccaatggatggtgctagtaaattttcttt |
5066898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University