View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10098_low_10 (Length: 423)
Name: NF10098_low_10
Description: NF10098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10098_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 280; Significance: 1e-156; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 280; E-Value: 1e-156
Query Start/End: Original strand, 120 - 414
Target Start/End: Complemental strand, 40103576 - 40103284
Alignment:
| Q |
120 |
tataaaatgcacaaagccgcatcagaaaccctggagaggcccccaacaatggagtggcaaaacaccaccttacggcgccgcagtaagcaactcgcaacga |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40103576 |
tataaaatgcacaaagccgcatcagaaaccctggagaggcccccaacaatggagtggcaa--caccaccttacggcgccgcagtaagcaactcgcaacga |
40103479 |
T |
 |
| Q |
220 |
caacaacctcctccttcacaggttagggttatcaacaatttttctccttttccgcatattcatcatttttctctacactttcgatttaaaacaggggaaa |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40103478 |
caacaacctcctccttcacaggttagggttatcaacaatttttctccttttccgcatattcatcatttttctctacactttcgatttaaaacaggggaaa |
40103379 |
T |
 |
| Q |
320 |
cacttattttctttcgatcaccgaaaatgtcaaggtgcataccaatggatcaactaaatcttgccacattccacaccattccctgttgcctatgc |
414 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40103378 |
cacttattttctttcgatcaccgaaaatgtcaaggtgcataccaatggatcaactaaatcttgccacattccacaccattccctgttgccaatgc |
40103284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 60 - 103
Target Start/End: Complemental strand, 40103665 - 40103622
Alignment:
| Q |
60 |
aaatcctctcgatttcgaattatatgttttaatataatttattt |
103 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40103665 |
aaatcctctcgatttcgaattatatattttaatataatttattt |
40103622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University