View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10098_low_16 (Length: 386)
Name: NF10098_low_16
Description: NF10098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10098_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 120; Significance: 3e-61; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 120; E-Value: 3e-61
Query Start/End: Original strand, 45 - 192
Target Start/End: Original strand, 13976417 - 13976564
Alignment:
Q |
45 |
gtgtcatgtcatgctgtcatgaaatcttaaccacaggatggatgagatgattcacagtctgacttgaataaatagattttaaattataaacttaaataat |
144 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
13976417 |
gtgtcatgtcatgctgtcaggaaatcttaaccacaggatggatgagatgattcacagtctgacttgattaaatagattttaaattataaacttaaataat |
13976516 |
T |
 |
Q |
145 |
cgaataactagtctatacaattgcacgcaggaatacctgatttacact |
192 |
Q |
|
|
|||| ||||||| |||||||||||| |||| |||||||||||||||| |
|
|
T |
13976517 |
cgaagaactagtttatacaattgcatgcagagatacctgatttacact |
13976564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 335 - 371
Target Start/End: Original strand, 13976587 - 13976623
Alignment:
Q |
335 |
tgtatatatacattaatcagggcccttagtcccttac |
371 |
Q |
|
|
||||||||||||||||||||||| ||||||||||||| |
|
|
T |
13976587 |
tgtatatatacattaatcagggcacttagtcccttac |
13976623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University