View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10098_low_19 (Length: 300)
Name: NF10098_low_19
Description: NF10098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10098_low_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 245; Significance: 1e-136; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 44 - 292
Target Start/End: Original strand, 19378424 - 19378672
Alignment:
Q |
44 |
atcataatgtcgatccaaaatgactagtctagtttgaaattatctgatgagtcaagcaaatgccagcttcattgtttcaatattgattaaatgcgacaat |
143 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
19378424 |
atcataatgtcgatccaaaatgactagtctagtttgaaattatctgatgagtcaagcaaatgccagcttcattgtttcaatattgattaaatgcgacaat |
19378523 |
T |
 |
Q |
144 |
acaatatgaaacagaaaggatgttgcaaagtcaatcacacaattttgtgaccccaacaagggtgatcttcaagaactcaatcaaactgaagattatgtta |
243 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
19378524 |
acaatatgaaacagaaaggatgttgcaaagtcaatcacacaattttgtgaccccaacaagggtgatcttcaagaactcaatcaaactgaagattatgttg |
19378623 |
T |
 |
Q |
244 |
attctcaactttcttgtgataatgatgaaagagaaccaccattatcatt |
292 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
19378624 |
attctcaactttcttgtgataatgatgaaagagaaccaccattatcatt |
19378672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 47 - 200
Target Start/End: Original strand, 18018522 - 18018691
Alignment:
Q |
47 |
ataatgtcgatccaaaatgactagtctagtttgaaattatctgatgagtcaagcaaatg---------------ccagcttcattgtttcaatattgatt |
131 |
Q |
|
|
||||||||||||||||||||||||||||||||||| || | |||||| |||||||||| ||||||||||||||||| |||||||| |
|
|
T |
18018522 |
ataatgtcgatccaaaatgactagtctagtttgaatttgtgtgatgattcaagcaaataatagagatagaatttccagcttcattgtttcactattgatt |
18018621 |
T |
 |
Q |
132 |
aaatgcgacaatacaatatgaaacagaaaggatgttgca-aagtcaatcacacaattttgtgaccccaac |
200 |
Q |
|
|
||||||||||||||||||||||||||| | | ||| ||| |||||||||||||||||||||||| ||||| |
|
|
T |
18018622 |
aaatgcgacaatacaatatgaaacagagatgttgtggcagaagtcaatcacacaattttgtgactccaac |
18018691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University