View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10098_low_22 (Length: 281)
Name: NF10098_low_22
Description: NF10098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10098_low_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 1 - 264
Target Start/End: Complemental strand, 43186147 - 43185884
Alignment:
| Q |
1 |
tacattctcttaagactagtgtcagtggtcctgtctccttgattcaacccaaagcgtgctcttgaaaatctcacttaactgattatgcttagcacgtgtt |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43186147 |
tacattctcttatgactagtgtcagtggtcctgtctccttgattcaacccaaagcgtgctcttgaaaatctcacttaactgattatgcttagcacgtgtt |
43186048 |
T |
 |
| Q |
101 |
attcttcttttttggcagaactgtttgtcttaagcaacacatacacatataggagtataacacttttgtgctaatgtgagtaacttgatgattcagttgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43186047 |
attcttcttttttggcagaactgtttgtcttaagcaacacatacacatataggagtataacacttttgtgctaatgtgagtaacttgatgattcagttgg |
43185948 |
T |
 |
| Q |
201 |
taaagattcaacttagatcttataagaaattggatttcaatcccgcttctgatatgataatttc |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43185947 |
taaagattcaacttagatcttataagaaattggatttcaatcccgcttctgatatgataatttc |
43185884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 27 - 70
Target Start/End: Complemental strand, 5039465 - 5039422
Alignment:
| Q |
27 |
ggtcctgtctccttgattcaacccaaagcgtgctcttgaaaatc |
70 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
5039465 |
ggtcctgtctccttaattcaacccaaagcgtgctcttaaaaatc |
5039422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University