View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10098_low_23 (Length: 279)
Name: NF10098_low_23
Description: NF10098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10098_low_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 2 - 261
Target Start/End: Original strand, 32134971 - 32135230
Alignment:
| Q |
2 |
gtcgtcgtcgccgccgtgagagttccaatcgcagcggtgacattgaactaggttttcggtgaagcaacgaactgaagcggcgtcgtttttgcagttttga |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32134971 |
gtcgtcgtcgccgccgtgagagttccaatcgcagcggtgacattgaactaggttttcggtgaagcaacgaactgaagcggcgtcgtttttgcagttttga |
32135070 |
T |
 |
| Q |
102 |
cagatttggaaacgcacgtgcttgagtgcgagtgcgtttgcggagtgcacgtgctggtcgcaaactaaacagagtttcgcggagtctggtttgcaatata |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32135071 |
cagatttggaaacgcacgtgcttgagtgcgagtgcgtttgcggagtgcacgtgctggtcgcaaactaaacagagtttcgcggagtctggtttgcaatata |
32135170 |
T |
 |
| Q |
202 |
gcaccgcgcttcttgtgtcgcaatagtcacacggaaacgacatcgttttaggaggatact |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32135171 |
gcaccgcgcttcttgtgtcgcaatagtcacacggaaacgacatcgttttaggaggatact |
32135230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University