View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10098_low_25 (Length: 276)
Name: NF10098_low_25
Description: NF10098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10098_low_25 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 146; Significance: 6e-77; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 45 - 265
Target Start/End: Complemental strand, 8353332 - 8353113
Alignment:
Q |
45 |
tttaatttttgtttataatgagaaattttggtcaaatctgattaatgacttcaatataagttgnnnnnnnnnaatccaaaaattgtaaatgtcactaatg |
144 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||| |||| ||||| |||||||||||||||| |
|
|
T |
8353332 |
tttaattttt-tttataatgagaaattttggtcaaatatgattaatgacttcaatataagttatgttttttttatccgaaaatcgtaaatgtcactaatg |
8353234 |
T |
 |
Q |
145 |
tcgattttaaagcagttcatgatagaaatccgtatctcgagactatagggtcaatttcttacactgagctaacacctcgtagactcaatatcagatgcgt |
244 |
Q |
|
|
|| |||||||||||||||||||||||||||||| ||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8353233 |
tccattttaaagcagttcatgatagaaatccgtctcttgagactatagggtcaatctcttacactgagctaacacctcgtagactcaatatcagatgcgt |
8353134 |
T |
 |
Q |
245 |
cgatcatagtcacatgccttt |
265 |
Q |
|
|
||| ||||||||||||||||| |
|
|
T |
8353133 |
cgagcatagtcacatgccttt |
8353113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University