View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10098_low_27 (Length: 261)
Name: NF10098_low_27
Description: NF10098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10098_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 1 - 253
Target Start/End: Original strand, 2875061 - 2875311
Alignment:
| Q |
1 |
acttttttattttcttctctctctctatgatatttaggtttctataatggcaacaattactatgacactttttctgcgaacccatatgcacaaagaaaca |
100 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2875061 |
actttttcattttcttctc--tctctatgatatttaggtttctataatggcaacaattactatgacactttttctgcgaacccatatgcacaaagaaaca |
2875158 |
T |
 |
| Q |
101 |
gtgattgatggacaaattcattttggtgctttatatttctcattgataatgctcatgtttaacggaactattgagcttacaatgacaattgtgaaacttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2875159 |
gtgattgatggacaaattcattttggtgctttatatttctcattgataatgctcatgtttaatggaactattgagcttacaatgacaattgtgaaacttc |
2875258 |
T |
 |
| Q |
201 |
caacattctttaagcaaagagaccacttattttatccttcatgggcctatgct |
253 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2875259 |
ctacattctttaagcaaagagaccacttattttatccttcatgggcttatgct |
2875311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University