View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10098_low_29 (Length: 257)
Name: NF10098_low_29
Description: NF10098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10098_low_29 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 27794793 - 27794554
Alignment:
| Q |
1 |
taaatatttttctagggtt-gattaaaatatcaagaaatataaatttttactgtatatacaattgcaaaataatttttaagaagcataacaagtccaagt |
99 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
27794793 |
taaatatttttctagggtttgattaaaatatcacgaaatataaatttttactgtatatacaattgcaaaataatttgtaagaagcataacaagtgcaagt |
27794694 |
T |
 |
| Q |
100 |
aaataatgctttattttgttttcacatgcttttgattgcactt--acccctacacccatgcacacaatttgagtttctttccttctacattttttaacaa |
197 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27794693 |
aaat---gctttattttgttttcacatgcttttgattgcacttttacccctacacccatgcacacaatttgagtttctttccttctacattttttaacac |
27794597 |
T |
 |
| Q |
198 |
ttcaaatagatgagaaacatagagagaatccagcatagtgaaa |
240 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
27794596 |
ttcaaaaagatgagaaacatagagagaatccagcatagtgaaa |
27794554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University