View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10098_low_30 (Length: 254)
Name: NF10098_low_30
Description: NF10098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10098_low_30 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 4 - 229
Target Start/End: Original strand, 5098811 - 5099038
Alignment:
| Q |
4 |
ttgtgtttgaattcttagttgagaaagtaaaagttgattttcctcatagaaatctaaatgaatca--gtttgataagatttcattaaatataacgcaatt |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5098811 |
ttgtgtttgaattcttagttgagaaagtaaaagttgattttcctcatagaaatctaaatgaatcaaagtttgataagatttcattaaatataacgcaatt |
5098910 |
T |
|
| Q |
102 |
cagtgcataaaactggtttgatttttggatagggcattcctcacccaagttctagaccctcatagaaaattttgcttgcatatataacatgtaagtcact |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
5098911 |
cagtgcataaaactggtttgatttttggatagggcattcctcacccaagttctagaccctcatagaaaatattgcttgcatatgtaacatgtaagtcact |
5099010 |
T |
|
| Q |
202 |
ttagctgccagataagtactgtttgggg |
229 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
5099011 |
ttagctgccagataagtactgtttgggg |
5099038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University