View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10098_low_34 (Length: 250)
Name: NF10098_low_34
Description: NF10098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10098_low_34 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 99; Significance: 6e-49; HSPs: 5)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 133 - 235
Target Start/End: Complemental strand, 5280529 - 5280427
Alignment:
| Q |
133 |
ggtccttgttttgcaagtacttaaaacaaaaacaagattaccgagactaataactcttggtaactctcctgttgtgtgcaggccttgtgggactgtctct |
232 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5280529 |
ggtccttgttttgcaagtacttaaaacagaaacaagattaccgagactaataactcttggtaactctcctgttgtgtgcaggccttgtgggactgtctct |
5280430 |
T |
|
| Q |
233 |
ttc |
235 |
Q |
| |
|
||| |
|
|
| T |
5280429 |
ttc |
5280427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 5280661 - 5280594
Alignment:
| Q |
1 |
atatgtatcaccaggtaataatatagtataggtataaaaatatatttggccctcgcaagtataccgta |
68 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5280661 |
atatgtatcaccaggtaataatatagtataggtataaaaatatatttggccctcgcaagtataccgta |
5280594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 179 - 235
Target Start/End: Complemental strand, 5288210 - 5288154
Alignment:
| Q |
179 |
ctaataactcttggtaactctcctgttgtgtgcaggccttgtgggactgtctctttc |
235 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
5288210 |
ctaataactcttggcaactcttctgttgtgtgcaggccttgtggggctgtctctttc |
5288154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 179 - 235
Target Start/End: Original strand, 5309022 - 5309078
Alignment:
| Q |
179 |
ctaataactcttggtaactctcctgttgtgtgcaggccttgtgggactgtctctttc |
235 |
Q |
| |
|
||||||||| |||| ||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
5309022 |
ctaataacttttggcaactctccttttttgtgcaggccttgtgggactgtctctttc |
5309078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 181 - 235
Target Start/End: Complemental strand, 14947443 - 14947386
Alignment:
| Q |
181 |
aataactcttggtaactctcctgttgtgtg---caggccttgtgggactgtctctttc |
235 |
Q |
| |
|
|||||||||||| |||||||||||| |||| |||||||||| |||||||||||||| |
|
|
| T |
14947443 |
aataactcttggcaactctcctgttctgtgttgcaggccttgttggactgtctctttc |
14947386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University