View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10098_low_35 (Length: 248)
Name: NF10098_low_35
Description: NF10098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10098_low_35 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 23 - 145
Target Start/End: Complemental strand, 49009302 - 49009180
Alignment:
| Q |
23 |
ccctccaactgtattttttaaatttatactgtttgaacatgagactttgcctaagcaaccaaagtcgagttacatttaaaacaatgtaatgttggtgagt |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49009302 |
ccctccaactgtattttttaaatttatactgtttgaacatgagactttgcctaagcaaccaaagtcgagttacatttaaaacaatgtaatgttggtgagt |
49009203 |
T |
 |
| Q |
123 |
ttttctatgatttggagattaac |
145 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
49009202 |
ttttctatgatttggagattaac |
49009180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University