View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10098_low_39 (Length: 240)
Name: NF10098_low_39
Description: NF10098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10098_low_39 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 40119548 - 40119326
Alignment:
Q |
1 |
tgagttaattgaaaattatctcaaattccctcaacagcccataacagcacaattatacacgaacaccccgacatgctccttcaaaccgagtacctgccaa |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40119548 |
tgagttaattgaaaattatctcaaattccctcaacagcccataacagcacaattatacacaaacaccccgacatgctccttcaaaccgagtacctgccaa |
40119449 |
T |
 |
Q |
101 |
tcgatggtgccatccctgacaccggatttaggacaccatgaattcagcacgatagcttcaccttctggacccctttgtccacctacgaccaaaagtttat |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40119448 |
tcgatggtgccatccctgacaccggatttaggacaccatgaattcagcacgatagcttcaccttctggacccctttgtccacctacgaccaaaagtttat |
40119349 |
T |
 |
Q |
201 |
ctccacaagccttgaaagcaagg |
223 |
Q |
|
|
||||||||||||||||||||||| |
|
|
T |
40119348 |
ctccacaagccttgaaagcaagg |
40119326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 156 - 223
Target Start/End: Original strand, 16146506 - 16146573
Alignment:
Q |
156 |
cttcaccttctggacccctttgtccacctacgaccaaaagtttatctccacaagccttgaaagcaagg |
223 |
Q |
|
|
|||| ||||| ||||| |||||||||||||| | ||| || |||||||||||| ||||||||||||| |
|
|
T |
16146506 |
cttccccttccggaccactttgtccacctacaaacaacagcttatctccacaaatcttgaaagcaagg |
16146573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University