View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10098_low_44 (Length: 227)
Name: NF10098_low_44
Description: NF10098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10098_low_44 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 134; Significance: 7e-70; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 32 - 201
Target Start/End: Complemental strand, 10724938 - 10724770
Alignment:
| Q |
32 |
tatcgttgttacataaatcactttcattttctcaaattactgttggtgccaacatatgagtatctatgtttgtgtcagtgtttcatagactccaattgct |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||| |||||||| ||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
10724938 |
tatcgttgttacataaatcactttcattttctcaaattactattggtgtcaacatatcagtatctatgtttgtctcggtgtttcatagactccaattgct |
10724839 |
T |
 |
| Q |
132 |
tcaagtatatgtaaaacatgaatctatggttaatgctcatagacccatttgattatatttatgcaattga |
201 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10724838 |
tcaagtatacgt-aaacatgaatctatggttaatgctcgtagacccatttgattatatttatgcaattga |
10724770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 199 - 227
Target Start/End: Complemental strand, 10724719 - 10724691
Alignment:
| Q |
199 |
tgatgatggctattatagtttatacatat |
227 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
10724719 |
tgatgatggctattatagtttatacatat |
10724691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University