View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10099_high_7 (Length: 265)
Name: NF10099_high_7
Description: NF10099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10099_high_7 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
| [»] scaffold0236 (1 HSPs) |
| | |
|
| [»] scaffold0036 (2 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 4 - 265
Target Start/End: Original strand, 37831049 - 37831310
Alignment:
| Q |
4 |
gaagtcagtttcttgactcaagnnnnnnngtcatattttggtgtcttctacgacgaaccgaggattgattggtggtggaatccgaatgagtgttgaaatt |
103 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
37831049 |
gaagtcagtttcttgactcaagtttttttgccatattttggtgtcttctacgacgaaccgaggattgattggtggtggaatctgaatgagtgttgaaatt |
37831148 |
T |
|
| Q |
104 |
tggctcagttgtggtgatgagaaggtgaggtaagggtttattggttttttagcattggatttggtgtgagtaccaggccataggtgtgtagattttgttc |
203 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
37831149 |
tggctcagttgtggttatgagaaggtgaggtaagggtttattggttttttagcattggatttggtgtgagtagcaggcgataggtgtgtagattttgttc |
37831248 |
T |
|
| Q |
204 |
ttgtggccattcgcgatgtagttatgaggttttgattcaacttttggctatgtgggtttgtg |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37831249 |
ttgtggccattcgcgatgtagttatgaggttttgattcaacttttggctatgtgggtttgtg |
37831310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 39 - 127
Target Start/End: Original strand, 28006672 - 28006760
Alignment:
| Q |
39 |
ttttggtgtcttctacgacgaaccgaggattgattggtggtggaatccgaatgagtgttgaaatttggctcagttgtggtgatgagaag |
127 |
Q |
| |
|
|||||||||||||| || | |||| ||||||||||||||||||||||||||||||||| | ||||||||||| |||||||||||||||| |
|
|
| T |
28006672 |
ttttggtgtcttctccgtcaaacctaggattgattggtggtggaatccgaatgagtgtgggaatttggctcaattgtggtgatgagaag |
28006760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 56; Significance: 3e-23; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 59 - 134
Target Start/End: Original strand, 8133528 - 8133603
Alignment:
| Q |
59 |
aaccgaggattgattggtggtggaatccgaatgagtgttgaaatttggctcagttgtggtgatgagaaggtgaggt |
134 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||| |||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
8133528 |
aaccgaggattaattggtggtggaattcgaatgagtgctgaaatttggttgagttgtggtgatgagaaggtgaggt |
8133603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 39 - 134
Target Start/End: Complemental strand, 2660841 - 2660746
Alignment:
| Q |
39 |
ttttggtgtcttctacgacgaaccgaggattgattggtggtggaatccgaatgagtgttgaaatttggctcagttgtggtgatgagaaggtgaggt |
134 |
Q |
| |
|
||||||| |||||| ||| ||||||||||||||| ||||| ||| ||| |||||| | |||||||||||| | ||||||||||||||||||| |
|
|
| T |
2660841 |
ttttggtatcttctctgacataccgaggattgattgatggtgaaatatgaacgagtgtgggaatttggctcagctcaggtgatgagaaggtgaggt |
2660746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0236 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: scaffold0236
Description:
Target: scaffold0236; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 39 - 132
Target Start/End: Complemental strand, 10402 - 10309
Alignment:
| Q |
39 |
ttttggtgtcttctacgacgaaccgaggattgattggtggtggaatccgaatgagtgttgaaatttggctcagttgtggtgatgagaaggtgag |
132 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||||||||||| ||||||| |||||| ||||||||| || |||||||||||||| |
|
|
| T |
10402 |
ttttggtgtcttctctaacaaaccgaggattgattggtggtggaatccaaatgagttcataaatttagctcagttgaggagatgagaaggtgag |
10309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 39 - 131
Target Start/End: Complemental strand, 24099255 - 24099163
Alignment:
| Q |
39 |
ttttggtgtcttctacgacgaaccgaggattgattggtggtggaatccgaatgagtgttgaaatttggctcagttgtggtgatgagaaggtga |
131 |
Q |
| |
|
|||| ||||||||| ||| |||||| |||||||||||||| |||||||| ||||||| |||| |||| |||||||||||||||||||||| |
|
|
| T |
24099255 |
ttttagtgtcttctccgagagaccgagagttgattggtggtggtatccgaataagtgttggaattaggctaagttgtggtgatgagaaggtga |
24099163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036 (Bit Score: 32; Significance: 0.000000006; HSPs: 2)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 37 - 124
Target Start/End: Complemental strand, 64282 - 64195
Alignment:
| Q |
37 |
tattttggtgtcttctacgacgaaccgaggattgattggtggtggaatccgaatgagtgttgaaatttggctcagttgtggtgatgag |
124 |
Q |
| |
|
|||||||| ||||||| |||| || |||||||||| |||||||||||| |||| ||| |||||| |||| |||||||||||||| |
|
|
| T |
64282 |
tattttggcgtcttctccgacagactgaggattgatcggtggtggaatctgaattagttcggaaattcggctatgttgtggtgatgag |
64195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 37 - 124
Target Start/End: Complemental strand, 69424 - 69337
Alignment:
| Q |
37 |
tattttggtgtcttctacgacgaaccgaggattgattggtggtggaatccgaatgagtgttgaaatttggctcagttgtggtgatgag |
124 |
Q |
| |
|
|||||||| ||||||| |||| || |||||||||| |||||||||||| |||| ||| |||||| |||| |||||||||||||| |
|
|
| T |
69424 |
tattttggcgtcttctccgacagactgaggattgatcggtggtggaatctgaattagttcggaaattcggctatgttgtggtgatgag |
69337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University