View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10099_low_11 (Length: 262)
Name: NF10099_low_11
Description: NF10099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10099_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 48537088 - 48536851
Alignment:
| Q |
1 |
tggctaatacactcttctttacttctttgctttaccgttctacgacggagcataaacgggatggtatgaactttcccttttcaccttttcataccctcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48537088 |
tggctaatacactcttctttacttctttgctttaccgttctacgacggagcataaacgggatggtatgaactttcccttttcaccttttcataccctcaa |
48536989 |
T |
 |
| Q |
101 |
catatttatttatttgcaattaaaagtttgttactctaagtctatttgtccaatacagtgtttgaaagcatcgtactttccctgaaattcaattgagctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48536988 |
catatttatttatttgcaattaaaagtttgttactctaagtctatttgtccaatacagtgtttgaaagcatcgtactttccctgaaattcaattgagctt |
48536889 |
T |
 |
| Q |
201 |
gtttttgtattggaaacattggttccttgatgtgtagt |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48536888 |
atttttgtattggaaacattggttccttgatgtgtagt |
48536851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University