View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10099_low_12 (Length: 261)
Name: NF10099_low_12
Description: NF10099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10099_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 10983077 - 10982836
Alignment:
| Q |
1 |
ttcaaccaatcaaatcctttgctttcccacttctccctcacagcgcaataaatgtacaatgaccacttaacttactgctaaaaacgtgccccttttattg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
10983077 |
ttcaaccaatcaaatcctttgctttcccacttctccctcacatcccaataaatgtacaatgaccaattaacttactgctaaaaacgtgccccttttattg |
10982978 |
T |
 |
| Q |
101 |
gtaatcgggtgatggagcagatcaaggaataaactgttgagaacatcagaagtcctcaaacagaatgaacggcagaagttgtgacagag-aacaacaatt |
199 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| | | | || ||||||||| |
|
|
| T |
10982977 |
gtaaccgggtgatggagcagatcaaggaataaactgttgagaacatcagaagtcctcaaacagaatgaacggcgtaagttttaatatagtcacaacaatt |
10982878 |
T |
 |
| Q |
200 |
tctttctccctcatagaacttctcttctcttcatcatctcct |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10982877 |
tctttctccctcatagaacttctcttctcttcatcatctcct |
10982836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University