View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10099_low_13 (Length: 260)
Name: NF10099_low_13
Description: NF10099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10099_low_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 62; Significance: 7e-27; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 172 - 253
Target Start/End: Original strand, 8528190 - 8528271
Alignment:
| Q |
172 |
attatcaacacgtttgctgttgtcaatttatgcagtgtgcgcattcatagatgcactgtaatttcctatgaatcttcatctc |
253 |
Q |
| |
|
|||||||||| |||| ||| |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8528190 |
attatcaacatgttttctggtgtcgatttatgcagtgtgcggattcatagatgcactgtaatttcctatgaatcttcatctc |
8528271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University