View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10099_low_2 (Length: 457)
Name: NF10099_low_2
Description: NF10099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10099_low_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 309
Target Start/End: Complemental strand, 7887842 - 7887537
Alignment:
Q |
1 |
acgtggaaatggggatgaacttaaattattttctaaggacacaaaaccacatgatcccatgaaaatggagaagataaagcttagtacaaagagggcatga |
100 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
7887842 |
acgtggaaatagggatgaacttaaattattttctaaggacacaaaaccacatgatcccatgaaaatggagaagataaagcttagtacaaagaggacatga |
7887743 |
T |
 |
Q |
101 |
agaagaagttggaatggaagctccatannnnnnnnnnnnnnnnnnnagtgatcaagacattatataatatgattgcgtgatcaagatattttgcaagttg |
200 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
T |
7887742 |
agaagaagttggaatggaagctccatatgttgtgtgtgtttgtgtgagtgatcaagacattatataatatgattgagtgatcaa---attttgcaagttg |
7887646 |
T |
 |
Q |
201 |
catggaccgttgacagtgacctgacactgaccacaatcattggtatatccctatttggaggatacattgattttttctggttacatgaggatgtattgct |
300 |
Q |
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7887645 |
cttggaccgttgacagtgacctgacactgaccacaatcattggtatatccctatttggaggatacattgattttttctggttacatgaggatgtattgct |
7887546 |
T |
 |
Q |
301 |
ttatacaca |
309 |
Q |
|
|
||||||||| |
|
|
T |
7887545 |
ttatacaca |
7887537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 384 - 441
Target Start/End: Complemental strand, 7887462 - 7887405
Alignment:
Q |
384 |
gttacaaccttaaacttatatttgaacccaagtaattaaatagataaaaggggaaact |
441 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
7887462 |
gttacaaccttaaacttatatttgaacccaagtaattaaatggataaaaggggaaact |
7887405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University