View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10099_low_9 (Length: 267)
Name: NF10099_low_9
Description: NF10099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10099_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 149; Significance: 9e-79; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 149; E-Value: 9e-79
Query Start/End: Original strand, 9 - 250
Target Start/End: Original strand, 12873644 - 12873884
Alignment:
| Q |
9 |
ttgtgaatttctttatatgtatgctaacataagcaattccatgtgttgtagatgataccaaaaggtttcactagaaaccttgtgagtgacatgtcaaacc |
108 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||| ||| | |||||||||||| ||||| |
|
|
| T |
12873644 |
ttgtgaatctctttatatgtatgctaacatacgcaattccatgcgttgtagatgataccaaaaggtttcactagggaccatatgagtgacatgttaaacc |
12873743 |
T |
 |
| Q |
109 |
caatgtttctcaagactccagatgggnnnnnnntgggaaatttgtacgactaaaatcaatggggatttttggtttcaaaagggttggaaagaatttgctg |
208 |
Q |
| |
|
|| |||||||||||||||||||| || |||||||| || ||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
12873744 |
cagtgtttctcaagactccagat-ggcaaaaaatgggaaatgtgcacgactaaaatcaatggggatatttggtttcaaaagggttggaaagaatttgcta |
12873842 |
T |
 |
| Q |
209 |
cacattattcactagattatgggcacatggtattgtttcaat |
250 |
Q |
| |
|
|| |||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
12873843 |
catattattcactagatcatgggcacatggtattatttcaat |
12873884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 167 - 250
Target Start/End: Original strand, 49164141 - 49164224
Alignment:
| Q |
167 |
atggggatttttggtttcaaaagggttggaaagaatttgctgcacattattcactagattatgggcacatggtattgtttcaat |
250 |
Q |
| |
|
|||| ||| ||||| |||||| ||||||||| ||||||||| ||||||||||| ||||| |||| |||||||| ||||||||| |
|
|
| T |
49164141 |
atggtgatatttggattcaaaggggttggaaggaatttgctacacattattcattagatcatggtcacatggtgctgtttcaat |
49164224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 100 - 132
Target Start/End: Original strand, 43750541 - 43750573
Alignment:
| Q |
100 |
tgtcaaacccaatgtttctcaagactccagatg |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
43750541 |
tgtcaaacccaatgtttctcaagactccagatg |
43750573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University