View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10100_high_10 (Length: 240)
Name: NF10100_high_10
Description: NF10100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10100_high_10 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 39627371 - 39627149
Alignment:
| Q |
18 |
gagcaaaaatttatggatagtatgtcatgtcatatcccatacaattgtaaaaggcgtactatcgactgaaaatcagtgccctgccatttccaaattaaac |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
39627371 |
gagcaaaaatttatggatagtatgtcatgtcatatcccatacaattgtaaaaggcgtactatcaactgaaaatcagtgccctgccatttccaaattaaac |
39627272 |
T |
 |
| Q |
118 |
agagcattttggcctgcatgtatttcataaaattttcaaaattggtaagtcaaggtttgagctttaatatacttagacaatcaaagaaaaccataaaaat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39627271 |
agagcattttggcctgcatgtatttcataaaaatttcaaaattggtaagtcaaggtttgagctttaatatacttagacaatcaaagaaaaccataaaaat |
39627172 |
T |
 |
| Q |
218 |
agcgtaagtagaaattgcacatt |
240 |
Q |
| |
|
|||||||||||||||| |||||| |
|
|
| T |
39627171 |
agcgtaagtagaaattacacatt |
39627149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University