View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10100_high_11 (Length: 228)
Name: NF10100_high_11
Description: NF10100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10100_high_11 |
 |  |
|
[»] chr8 (2 HSPs) |
 |  |
|
[»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 6071263 - 6071490
Alignment:
Q |
1 |
ctcaattttaaaactttatgcactgtcgcattagaatgcttaccaagtttcttaaaagcactctcccaaaattcaatctctcttgaacgaagaagtaaag |
100 |
Q |
|
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6071263 |
ctcaattttaaaacttcatgcactgtcgcattagaatgcttaccaagtttcttaaaagcactctcccaaaattcaatctctcttgaacgaagaagtaaag |
6071362 |
T |
 |
Q |
101 |
caaaaactttaagggccagtggaacgccccctgcataagtgatcgccctttgcaagagatgctcatacttctctcggggatgacttggcacgaaagcttc |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6071363 |
caaaaactttaagggccagtggaacgccccctgcataagtgaccgccctttgcaagagatgctcatacttctctcggggatgacttggcacgaaagcttc |
6071462 |
T |
 |
Q |
201 |
aaggcagaaaagctctagagattttgga |
228 |
Q |
|
|
|||||||||||||||||||||||||||| |
|
|
T |
6071463 |
aaggcagaaaagctctagagattttgga |
6071490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 46 - 228
Target Start/End: Original strand, 6195591 - 6195773
Alignment:
Q |
46 |
agtttcttaaaagcactctcccaaaattcaatctctcttgaacgaagaagtaaagcaaaaactttaagggccagtggaacgccccctgcataagtgatcg |
145 |
Q |
|
|
||||||||||||| ||| ||||||||| |||| ||||||| ||||||| ||||||| |||| ||||||||| || ||||||||||||||||||||||| | |
|
|
T |
6195591 |
agtttcttaaaagaactttcccaaaatgcaatatctcttgtacgaagatgtaaagccaaaagtttaagggcaagcggaacgccccctgcataagtgattg |
6195690 |
T |
 |
Q |
146 |
ccctttgcaagagatgctcatacttctctcggggatgacttggcacgaaagcttcaaggcagaaaagctctagagattttgga |
228 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||| ||||||| | || ||||| ||||| ||||||||||||||||||||| |
|
|
T |
6195691 |
ccctttgcaaaagatgctcatacttctctcggggattacttggctcaaaggcttctaggcaaaaaagctctagagattttgga |
6195773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 46 - 228
Target Start/End: Complemental strand, 37451385 - 37451203
Alignment:
Q |
46 |
agtttcttaaaagcactctcccaaaattcaatctctcttgaacgaagaagtaaagcaaaaactttaagggccagtggaacgccccctgcataagtgatcg |
145 |
Q |
|
|
|||||||| |||| ||| ||||||||||||||||||||||||||||| ||||||| |||| ||||||||| |||||||||||||||||||||||||| | |
|
|
T |
37451385 |
agtttcttgaaagaacttacccaaaattcaatctctcttgaacgaagatgtaaagccaaaagtttaagggcaagtggaacgccccctgcataagtgattg |
37451286 |
T |
 |
Q |
146 |
ccctttgcaagagatgctcatacttctctcggggatgacttggcacgaaagcttcaaggcagaaaagctctagagattttgga |
228 |
Q |
|
|
|| ||||||||||||||||||||||||| || |||| ||||||| |||||||||| || || ||||||||||||||||||||| |
|
|
T |
37451285 |
ccttttgcaagagatgctcatacttctcgcgaggattacttggctcgaaagcttctagacaaaaaagctctagagattttgga |
37451203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University