View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10100_low_10 (Length: 324)
Name: NF10100_low_10
Description: NF10100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10100_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 10 - 308
Target Start/End: Original strand, 50039419 - 50039717
Alignment:
| Q |
10 |
atgagagggaaaactttgaggtcaagtcacagcccgtggtgtgcgcaaatatttaagctagatctaaaatgtgtgatttctaataaatacttttattaaa |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
50039419 |
atgagagggaaaactttgaggtcaagtcacagcccgtggtgtgcgcaaatatttaagctagatctaaaatgtgtgatttctcataaatacttttattaaa |
50039518 |
T |
|
| Q |
110 |
gaattactttcattttaaacttcttaattagacgtttaaccactccgtatctttttgttttcaaatgcacgtatccgtatcatctaactcgataaattct |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50039519 |
gaattactttcattttaaacttcttaattagacgtttaaccactccgtatctttttgttttcaaatgcacgtatccgtatcatctaactcgataaattct |
50039618 |
T |
|
| Q |
210 |
tacttgctgctgcagtttctatattgaccagcttttgtatacattctgtccgtcttaatattaaaatatcaatgtgttgggaatttaccagacactttc |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50039619 |
tacttgctgctgcagtttctatattgaccagcttttgtatacattctgtccgtcttaatattaaaatatcaatgtgttgggaatttaccagacactttc |
50039717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University