View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10100_low_12 (Length: 303)
Name: NF10100_low_12
Description: NF10100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10100_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 150; Significance: 3e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 28 - 227
Target Start/End: Complemental strand, 49626087 - 49625887
Alignment:
Q |
28 |
gttggaaaactccttataaccttttttcaaatatagtttttgatgacatagcaattggtagaattaaggaagccnnnnnnnnnnnnn-ttaattggagag |
126 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
49626087 |
gttggaaaactccttataaccttttttcgaatatagtttttgatgacatagcaattggtagaattaaggaagccaaaaagaaaaaaaattaattggagag |
49625988 |
T |
 |
Q |
127 |
gttaccttaccctaccctagtgcgcactggctggctagagatttgtccgagaatcgagggagggacttgaataattttggcagtatataaagccaccata |
226 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
49625987 |
gttaccttaccctaccctagtgcgcactggctggctagagatttgtccgagaatcgagggagggacttgaataattttggcagtatataaagccaccata |
49625888 |
T |
 |
Q |
227 |
a |
227 |
Q |
|
|
| |
|
|
T |
49625887 |
a |
49625887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University