View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10100_low_13 (Length: 293)
Name: NF10100_low_13
Description: NF10100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10100_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 7 - 124
Target Start/End: Original strand, 43400209 - 43400326
Alignment:
| Q |
7 |
gcaatgagtctcaataggatttggactctacacaataacaatgtgacgcagttattgattttgaccgcccgataccgattgtatatgtaagtttacatgg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43400209 |
gcaatgagtctcaataggatttggactctacacaataacaatgtgacgcagttattgattttgaccgcccgataccgattgtatatgtaagtttacatgg |
43400308 |
T |
|
| Q |
107 |
ccattgtcacttttctgg |
124 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
43400309 |
ccattgtcacttttctgg |
43400326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 152 - 278
Target Start/End: Original strand, 43400354 - 43400480
Alignment:
| Q |
152 |
gatatttgtgatgaagaatgcatatgggcctaccaactatttttctttgagaaatcagcctctgtcgcatttttctggatctttcaagctgcctcattat |
251 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43400354 |
gatattggtgatgaagaatgcatatgggcctaccaactatttttctttgagaaatcagcctctgtcgcatttttctggatctttcaagctgcctcattaa |
43400453 |
T |
|
| Q |
252 |
tattgtttttgacattgatgtagatca |
278 |
Q |
| |
|
||||||||||||| ||||||||||||| |
|
|
| T |
43400454 |
tattgtttttgacgttgatgtagatca |
43400480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University