View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10100_low_24 (Length: 242)
Name: NF10100_low_24
Description: NF10100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10100_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 18 - 241
Target Start/End: Complemental strand, 29175231 - 29175008
Alignment:
| Q |
18 |
acagacaaaggaggtaacagacaagtacatcactaatgatggcatgtcttgtgttattgtttttctttggctaagtgttaaattatatcaagggttgtct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29175231 |
acagacaaaggaggtaacagacaagtacatcactaatgatggcatgtcttgtgttattgtttttctttggctaagtgttaaattatatcaagggttgtct |
29175132 |
T |
 |
| Q |
118 |
tataagttatataactcattggaggccgtcttctctttttcaattcagggcgtatgcggaagttcttacttggacttatgacaaaagtgtggctcaggct |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
29175131 |
tataagttatataactcattggaggccgtcttctctttttcaattcagggcgtatgcggaagttcttacttggacttatgacaaaagcgtggctcaggct |
29175032 |
T |
 |
| Q |
218 |
agcgtgagcgagcctagcatatcg |
241 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
29175031 |
agcgtgagcgagcctagcatatcg |
29175008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University