View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10101_high_17 (Length: 240)

Name: NF10101_high_17
Description: NF10101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10101_high_17
NF10101_high_17
[»] chr5 (1 HSPs)
chr5 (1-222)||(27526579-27526800)


Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 27526800 - 27526579
Alignment:
1 ttattgcctttgaagttaccatgttgcagtcaatcatgcttatacatttggaaaaccctctatgattattggatatgaatttttgggcagttttggataa 100  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
27526800 ttattgcctttgaagttaccatgttgcagtcaattatgcttatacatttggaaaaccctctatgattattggatatgaatttttgggcagttatggataa 27526701  T
101 catttcagctaggatatcatctatacataccattggttggctttgtgacgagaggccaatataagccatagtaataataagatggtttatgattgcttat 200  Q
    | ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27526700 cctttcagctaggatatcatctatacataccattggttggcattgtgacgagaggccaatataagccatagtaataataagatggtttatgattgcttat 27526601  T
201 ggtggttactgtatttttctac 222  Q
    |||||||| |||||||||||||    
27526600 ggtggttagtgtatttttctac 27526579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University