View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10101_high_17 (Length: 240)
Name: NF10101_high_17
Description: NF10101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10101_high_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 27526800 - 27526579
Alignment:
| Q |
1 |
ttattgcctttgaagttaccatgttgcagtcaatcatgcttatacatttggaaaaccctctatgattattggatatgaatttttgggcagttttggataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
27526800 |
ttattgcctttgaagttaccatgttgcagtcaattatgcttatacatttggaaaaccctctatgattattggatatgaatttttgggcagttatggataa |
27526701 |
T |
 |
| Q |
101 |
catttcagctaggatatcatctatacataccattggttggctttgtgacgagaggccaatataagccatagtaataataagatggtttatgattgcttat |
200 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27526700 |
cctttcagctaggatatcatctatacataccattggttggcattgtgacgagaggccaatataagccatagtaataataagatggtttatgattgcttat |
27526601 |
T |
 |
| Q |
201 |
ggtggttactgtatttttctac |
222 |
Q |
| |
|
|||||||| ||||||||||||| |
|
|
| T |
27526600 |
ggtggttagtgtatttttctac |
27526579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University