View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10101_high_19 (Length: 236)
Name: NF10101_high_19
Description: NF10101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10101_high_19 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 14 - 236
Target Start/End: Complemental strand, 10856837 - 10856615
Alignment:
| Q |
14 |
taatcagcattaggtctttcagcagagaacaactcttcaagtaaaccatgtctgaattccaactttcttataatgggtaacatgccaaggaaccgatata |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10856837 |
taatcagcattaggtctttcagcagagaacaactcttcaagtaaaccatatctgaattccaactttcttataatgggtaacatgccaaggaaccgatata |
10856738 |
T |
 |
| Q |
114 |
gaacactatctgactcttcttgaaagcattgcagtttttcaaattctaatttacaagacttcggattccatgtaaccttggtgtctccaataccaaatga |
213 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10856737 |
gaacactatctgactcttgttgaaagcattccagtttttcaaattgtaatttacaagacttcggattccatgtaacctcggtgtctccaataccaaatga |
10856638 |
T |
 |
| Q |
214 |
taaatgcttcatactaggaatct |
236 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
10856637 |
taaatgcttcatactaggaatct |
10856615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 14 - 158
Target Start/End: Complemental strand, 10888340 - 10888196
Alignment:
| Q |
14 |
taatcagcattaggtctttcagcagagaacaactcttcaagtaaaccatgtctgaattccaactttcttataatgggtaacatgccaaggaaccgatata |
113 |
Q |
| |
|
|||||||||||||||||||||| |||||| | |||||||| |||| || ||||| | ||||| |||| |||||||||||||||||| || | |
|
|
| T |
10888340 |
taatcagcattaggtctttcaggagagaatatctcttcaaccaaacaattatcaaattcaagctttcctatagcaggtaacatgccaaggaacacatgca |
10888241 |
T |
 |
| Q |
114 |
gaacactatctgactcttcttgaaagcattgcagtttttcaaatt |
158 |
Q |
| |
|
| |||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
10888240 |
gcacactatctgactcttcttgaaagtgttgcagtttgtcaaatt |
10888196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University