View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10101_low_10 (Length: 384)
Name: NF10101_low_10
Description: NF10101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10101_low_10 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 82; Significance: 1e-38; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 17 - 114
Target Start/End: Complemental strand, 5266754 - 5266657
Alignment:
| Q |
17 |
gatgccaaacttgtttgtgacaatgaacacacttttatgcaaatttatgctgattttgcgacacaaataagaccatagtagtggcacaaatcaaactg |
114 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5266754 |
gatgccgaacttgtttgcgacaatgaacacacttttatgcaaagttacgctgattttgcgacacaaataagaccatagtagtggcacaaatcaaactg |
5266657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 253 - 325
Target Start/End: Original strand, 5059278 - 5059350
Alignment:
| Q |
253 |
tccagtttttaaaacattggtacaaagtgaatgttcaaacttttcttaagggatgattttacaatgagaaaac |
325 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||| || ||||||| |
|
|
| T |
5059278 |
tccagtttttaaaacattggcacaaagtgaatgttcatacttttcttaagggatgattttaccataagaaaac |
5059350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 285 - 321
Target Start/End: Original strand, 5168671 - 5168707
Alignment:
| Q |
285 |
gttcaaacttttcttaagggatgattttacaatgaga |
321 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
5168671 |
gttcaaactttttttaagtgatgattttacaatgaga |
5168707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University