View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10101_low_21 (Length: 261)
Name: NF10101_low_21
Description: NF10101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10101_low_21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 23 - 250
Target Start/End: Original strand, 30273742 - 30273969
Alignment:
| Q |
23 |
atgcaccgtaagtctaaaactttcaatccaattatgtgctatgatttttatgaatcataccttctcaaaggcatgcctcaaagctagaggatcataagga |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30273742 |
atgcaccgtaagtctaaaactttcaatccaattatgtgctatgatttttatgaatcataccttctcaaaggcatgcctcaaagctagaggatcataagga |
30273841 |
T |
|
| Q |
123 |
gctgatggaatagcctcagagtaccaaggaggattgtaccatcttctaaatccaccatctttgctagagtacaaatgaccaggtggaaaacactcaaaat |
222 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30273842 |
gctgatggaatagcctcagagtaccagggaggattgtaccatcttctaaatccaccatctttgctagagtacaaatgaccaggtggaaaacactcaaaat |
30273941 |
T |
|
| Q |
223 |
gttcacaatcatcattcaatgctttcat |
250 |
Q |
| |
|
||||||||||||||||||| |||||||| |
|
|
| T |
30273942 |
gttcacaatcatcattcaaggctttcat |
30273969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 80 - 240
Target Start/End: Original strand, 25966626 - 25966789
Alignment:
| Q |
80 |
taccttctcaaaggcatgcctcaaagctagaggatcataaggagctgatggaata---gcctcagagtaccaaggaggattgtaccatcttctaaatcca |
176 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||||||| | || ||||||| ||||| | |||| ||||||||||||||||| | ||| | |
|
|
| T |
25966626 |
taccttctcaaaggcattcctcaaaactagaggatcataaggggttgttggaataatagcctcgttgaaccacggaggattgtaccatctacgaaactcc |
25966725 |
T |
|
| Q |
177 |
ccatctttgctagagtacaaatgaccaggtggaaaacactcaaaatgttcacaatcatcattca |
240 |
Q |
| |
|
| |||||||| |||||||| ||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
25966726 |
cggtctttgctcgagtacaagtgaccaggtggaaaaacttcaaaatgttcacattcatcattca |
25966789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University