View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10101_low_25 (Length: 250)
Name: NF10101_low_25
Description: NF10101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10101_low_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 99; Significance: 6e-49; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 1 - 99
Target Start/End: Complemental strand, 34306472 - 34306374
Alignment:
| Q |
1 |
tttgactgtcaaacctaacttatgtttgttctattgttgatgactactaggtggttacgctaagtgtatatgtctaattatgtttgaaaataaatatta |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34306472 |
tttgactgtcaaacctaacttatgtttgttctattgttgatgactactaggtggttacgctaagtgtatatgtctaattatgtttgaaaataaatatta |
34306374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 175 - 240
Target Start/End: Complemental strand, 34306376 - 34306310
Alignment:
| Q |
175 |
ttatgtgtttattttataaaaatagttatttgattgtaa-ctaaaagtatgctccctgtcacctatg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||| ||||||| |
|
|
| T |
34306376 |
ttatgtgtttattttataaaaatagttatttgattgtaaccaaaaagtatgctccctgtgacctatg |
34306310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University