View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10101_low_27 (Length: 249)
Name: NF10101_low_27
Description: NF10101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10101_low_27 |
 | |
|
| [»] scaffold0003 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0003 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 343650 - 343880
Alignment:
| Q |
1 |
ccttactagtagaaaataaaggattatctaatgatgattgatgataatggtagtagtagcaataatatttgatagagccatgaaacaaaatgtcaatatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
343650 |
ccttactagtagaaaataaaggattatctaatgatgattgatgataatggtagtagtaacaataatatttgatagagccatgaaacaaaatgtcaatatt |
343749 |
T |
|
| Q |
101 |
gtactatgtctcttcattgattatataccacagcacccatacaacaaagtgttgcttctcattcttctctactctactagttcaaatacttagtatgaag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
343750 |
gtactatgtctcttcattgattatataccacagcacccacacaacaaagtgttgcttctcattcttctctactctactagttcaaatacttagtatgaag |
343849 |
T |
|
| Q |
201 |
gactatgatgtgtatagtaaaagctctgaag |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
343850 |
gactatgatgtgtatagtaaaagctctgaag |
343880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University