View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10101_low_28 (Length: 245)
Name: NF10101_low_28
Description: NF10101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10101_low_28 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 17 - 230
Target Start/End: Complemental strand, 38456283 - 38456070
Alignment:
| Q |
17 |
gaaacaatagtttgaacccataaaaaatcttttttaccattcactccggctctcccatccgttctcactatgtatttgtcgtcgttgccaacgttggggt |
116 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
38456283 |
gaaacaatagtttgaacccagaaaaaatcttctttaccattcactccggctctcccatccgttctcactatatatttgtcgtcgttgccgacgttggggt |
38456184 |
T |
|
| Q |
117 |
tctcaccataaattcagatctcgtggtttcaattcattgttacaaccatgtacatcacccattgttcaacctattgaactttcaatcccaaagttatttc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
38456183 |
tctcaccataaattcagatctcgtggtttcaattcattgttacaaccatgtacatcacccattgttcaacccattgaactttcaatcccaaagttatttc |
38456084 |
T |
|
| Q |
217 |
tgccccctcaatct |
230 |
Q |
| |
|
||||||||||||| |
|
|
| T |
38456083 |
cgccccctcaatct |
38456070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 112 - 164
Target Start/End: Complemental strand, 55345852 - 55345800
Alignment:
| Q |
112 |
ggggttctcaccataaattcagatctcgtggtttcaattcattgttacaacca |
164 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||| |||| |||||||||||| |
|
|
| T |
55345852 |
ggggttctcaccataaaactagatctcgtcgtttcgattcgttgttacaacca |
55345800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University