View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10101_low_29 (Length: 243)
Name: NF10101_low_29
Description: NF10101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10101_low_29 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 18 - 243
Target Start/End: Original strand, 34126659 - 34126883
Alignment:
| Q |
18 |
tctatagattgcaaatagtgtgtataaattaggattttacgatcccctcaaannnnnnnnnnnnnnnnnaagattttaccaaattactttt-atcaatta |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
34126659 |
tctatagattgcaaatagtgtgtataaattaggattttacgataccctcaa-tttttttttttttttttaagattttaccaaattactttttatcaatta |
34126757 |
T |
|
| Q |
117 |
ttgagatgtcctcgtgagcataactcagttgttaggttcaaactccgaccaccacnnnnnnnnnnctattgagatgacgttgtaaaaaactattaagacg |
216 |
Q |
| |
|
|||||||||| ||||||||||| |||||||| ||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34126758 |
ttgagatgtcatcgtgagcatagctcagttgataggttcaaaccccgaccacca-taaaaaaaaactattgagatgacgttgtaaaaaactattaagacg |
34126856 |
T |
|
| Q |
217 |
acgtagtgacaaccattttgagacatt |
243 |
Q |
| |
|
||||||||||||| ||||||||||||| |
|
|
| T |
34126857 |
acgtagtgacaactattttgagacatt |
34126883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University