View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10101_low_31 (Length: 242)
Name: NF10101_low_31
Description: NF10101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10101_low_31 |
 |  |
|
[»] chr7 (4 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 4e-93; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 8 - 242
Target Start/End: Complemental strand, 48453512 - 48453276
Alignment:
Q |
8 |
tggacatcatcttttctggattttaaacatcctacaagtttctcctcttctgcagaaactttcggttatggtgagcgaacatggttaatgcacacctttt |
107 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
48453512 |
tggacatcatcttttctggattttaaacatcctacaagtttctcctcttttgcagaaacttttggttatggtgagcgaacatggttaatgcacacctttt |
48453413 |
T |
 |
Q |
108 |
attattattattttttgtggttatcatcctgactttgagcaagaactttgtaaattaagttatacatttgatccttctt--cnnnnnnnnnnnggttata |
205 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| ||||||| |
|
|
T |
48453412 |
attattattattttttgtggttatcatcctgactttgagcaagaacttcgtaaattaagttatacatttgatacttctttaaaaaaaaaaaaaggttata |
48453313 |
T |
 |
Q |
206 |
cttttgagctggagaatcatgcaatcaagatcgttgc |
242 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |
|
|
T |
48453312 |
cttttgagctggagaatcatgcaatcaagatcgttgc |
48453276 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 17 - 89
Target Start/End: Original strand, 47929059 - 47929131
Alignment:
Q |
17 |
tcttttctggattttaaacatcctacaagtttctcctcttctgcagaaactttcggttatggtgagcgaacat |
89 |
Q |
|
|
|||||| ||||||||||||||||| |||| ||||||||||||||||||||| || || |||||||| |||||| |
|
|
T |
47929059 |
tcttttgtggattttaaacatccttcaagcttctcctcttctgcagaaactctctgtcatggtgagtgaacat |
47929131 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 17 - 90
Target Start/End: Complemental strand, 47051406 - 47051333
Alignment:
Q |
17 |
tcttttctggattttaaacatcctacaagtttctcctcttctgcagaaactttcggttatggtgagcgaacatg |
90 |
Q |
|
|
|||||| |||||||||||||| || |||| |||||||||| ||||||||||||| | |||||||| ||||||| |
|
|
T |
47051406 |
tcttttgtggattttaaacatgcttcaagcttctcctcttttgcagaaactttcaatcatggtgagtgaacatg |
47051333 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 48107571 - 48107506
Alignment:
Q |
24 |
tggattttaaacatcctacaagtttctcctcttctgcagaaactttcggttatggtgagcgaacat |
89 |
Q |
|
|
||||||||||||||||| ||||||| |||| || ||||||||||||| | |||||||| |||||| |
|
|
T |
48107571 |
tggattttaaacatccttcaagtttgtccttttttgcagaaactttcagccatggtgagtgaacat |
48107506 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University