View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10101_low_33 (Length: 240)
Name: NF10101_low_33
Description: NF10101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10101_low_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 21835601 - 21835377
Alignment:
| Q |
1 |
cccaactaacaatcacaactgcaaaaatatagatccagcggctagatactaccagaactttgggctagatccttttattacgggtctcttttcactttca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21835601 |
cccaactaacaatcacaactgcaaaaatatagatccagcggctagatactaccagaactttgggctagatccttttattacgggtctcttttcactttca |
21835502 |
T |
 |
| Q |
101 |
gaaccgagtctccgaaaacttaggaacagccctgctattcatatatacctaaataaatgtgttattaagacacaaatacatatagagtttttgtcattcg |
200 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
21835501 |
gaaccgagtctccgaaaacttaggaacggccctgctattcatatatacctaaataaatgtgttattaagacacaagtacatatagagtttttgtcattcg |
21835402 |
T |
 |
| Q |
201 |
tattgaagctcatatatgctataac |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
21835401 |
tattgaagctcatatatgctataac |
21835377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 73 - 113
Target Start/End: Original strand, 27112157 - 27112197
Alignment:
| Q |
73 |
ttttattacgggtctcttttcactttcagaaccgagtctcc |
113 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
27112157 |
ttttattacgggtctcttttcacttacagaaccgagcctcc |
27112197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 73 - 114
Target Start/End: Complemental strand, 26718926 - 26718885
Alignment:
| Q |
73 |
ttttattacgggtctcttttcactttcagaaccgagtctccg |
114 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
26718926 |
ttttattacgggtctcttttcacttacagaaccgagcctccg |
26718885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 73 - 114
Target Start/End: Complemental strand, 26988670 - 26988629
Alignment:
| Q |
73 |
ttttattacgggtctcttttcactttcagaaccgagtctccg |
114 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
26988670 |
ttttattacgggtctcttttcacttacagaaccgagcctccg |
26988629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 73 - 113
Target Start/End: Complemental strand, 2477565 - 2477525
Alignment:
| Q |
73 |
ttttattacgggtctcttttcactttcagaaccgagtctcc |
113 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
2477565 |
ttttattacgggtctcttttcacttacagaaccgagcctcc |
2477525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 73 - 113
Target Start/End: Original strand, 6221810 - 6221850
Alignment:
| Q |
73 |
ttttattacgggtctcttttcactttcagaaccgagtctcc |
113 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
6221810 |
ttttattacgggtctcttttcatttacagaaccgagtctcc |
6221850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000005; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 73 - 108
Target Start/End: Complemental strand, 11952569 - 11952534
Alignment:
| Q |
73 |
ttttattacgggtctcttttcactttcagaaccgag |
108 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |
|
|
| T |
11952569 |
ttttattacgggtctcttttcacttacagaaccgag |
11952534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 73 - 127
Target Start/End: Original strand, 37182766 - 37182820
Alignment:
| Q |
73 |
ttttattacgggtctcttttcactttcagaaccgagtctccgaaaacttaggaac |
127 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||||| ||||| | ||||||||| |
|
|
| T |
37182766 |
ttttattacgggtctcttttcacttacagagccgagcctccggattcttaggaac |
37182820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 73 - 114
Target Start/End: Original strand, 12694801 - 12694842
Alignment:
| Q |
73 |
ttttattacgggtctcttttcactttcagaaccgagtctccg |
114 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||||| ||||| |
|
|
| T |
12694801 |
ttttattacgggtctcttttcacttacagagccgagcctccg |
12694842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 73 - 134
Target Start/End: Complemental strand, 39332388 - 39332327
Alignment:
| Q |
73 |
ttttattacgggtctcttttcactttcagaaccgagtctccgaaaacttaggaacagccctg |
134 |
Q |
| |
|
|||||||||| |||||||||||| | |||||||||| ||||||| | ||||||| |||||| |
|
|
| T |
39332388 |
ttttattacgagtctcttttcacctacagaaccgagcctccgaattcgtaggaacggccctg |
39332327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University