View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10101_low_40 (Length: 227)
Name: NF10101_low_40
Description: NF10101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10101_low_40 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 27527143 - 27526919
Alignment:
| Q |
1 |
tagatgcttacattcattaatcttgttgatctcagtcccaaaccacctccataagatggtaaacaatttatgtgtcaaggtagagtacaactttcttagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
27527143 |
tagatgcttacattcattaatcttgttgatctcagtcctaaaccacctccataagatggtaaacaatttctgtgtcaaggtagagtacaactttcttagt |
27527044 |
T |
 |
| Q |
101 |
attaatatatttacttaaccaacttctaattattttcacaatcgtatattacac--ataaatgttgatagagtaggatgttgtgaatccaattgcaaaat |
198 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27527043 |
attaatatctttacttaaccaacttctaattattttcacaatcgtatattacacatataaatgttgatagagtaggatgttgtgaatccaattgcaaaat |
27526944 |
T |
 |
| Q |
199 |
atgttattgaatccaagccaaaacc |
223 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
27526943 |
atgttattgaatccaagccaaaacc |
27526919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University