View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10101_low_42 (Length: 206)
Name: NF10101_low_42
Description: NF10101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10101_low_42 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 15 - 183
Target Start/End: Original strand, 20368793 - 20368961
Alignment:
| Q |
15 |
tgagatgaagtcaggaatataaaataaagttggtaatgaaccaactttgaaatcagataaattttgctgttcttgttcaattttttccattacagtgcaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| | |||||||||||||||||||||||||| |
|
|
| T |
20368793 |
tgagatgaagtcaggaatataaaataaagttggtaatgaaccaactttgaaatcagataaattttggtgttttggttcaattttttccattacagtgcaa |
20368892 |
T |
 |
| Q |
115 |
aatcaaggttatggaatgtgatgagaaggaataagaagggttatgagagtttgcggtttgggatgaagt |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
20368893 |
aatcaaggttatggaatgtgatgagaaggaataagaagggttatgagagtttgctgtttgggatgaagt |
20368961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University