View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10101_low_43 (Length: 206)
Name: NF10101_low_43
Description: NF10101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10101_low_43 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 7 - 196
Target Start/End: Complemental strand, 45616077 - 45615885
Alignment:
| Q |
7 |
ttatttttgactgatgtcttaaccacccattttct-taatgatttcttttccaaaattctatttctaaaagggcaagctggtatcctactttgaacctag |
105 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45616077 |
ttatttttgactgatgacttaaccaaccattttctctaatgatttcttttcaaaaattctatttctaaaagggcaagctggtatcctactttgaacctag |
45615978 |
T |
 |
| Q |
106 |
ctatattcttagatggaccctacttatggtttataatc--ttctattagttcaaattccagagcggcataaataaagagtagccacaggttct |
196 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| | |||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45615977 |
ctatattcttagatggaccctacttatggcttataatctgtgctattagtccaaattccagagcggcataaataaagagtagccacaggttct |
45615885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University