View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10101_low_44 (Length: 205)
Name: NF10101_low_44
Description: NF10101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10101_low_44 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 18 - 197
Target Start/End: Original strand, 43107123 - 43107302
Alignment:
Q |
18 |
ataacgacccagttgagtcttttttcaattccattcaagttatgaaggaatcactgtcaccacttgaagtgggttttcgcaaagctgcaaaggattttga |
117 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43107123 |
ataacgacccagttgagtcttttttcaattccattcaagttatgaaggaatcactgtcaccacttgaagtgggttttcgcaaagctgcaaaggattttga |
43107222 |
T |
 |
Q |
118 |
gcattgttttgctaagaataagacacaaggtgtttgtttaattgctcaagtgaaagatggtggtgattttcagatctgtg |
197 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43107223 |
gcattgttttgctaagaataagacacaaggtgtttgtttaattgctcaagtgaaagatggtggtgattttcagatctgtg |
43107302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University